Skip to main content
Immunology logoLink to Immunology
. 2001 Mar;102(3):273–280. doi: 10.1046/j.1365-2567.2001.01159.x

Molecular structure of eight human autoreactive monoclonal antibodies

I Aguilera 1, J Melero 1,*, A Nuñez-Roldan 1, B Sanchez 1
PMCID: PMC1783190  PMID: 11298825

Abstract

The heavy (H) and light (L) chain V-region sequences of eight human autoreactive immunoglobulin M (IgM) monoclonal antibodies (mAbs: BY-4, BY-7, BY-12, IRM-3, IRM-7, IRM-8, IRM-10 and CDC-1) were determined at the cDNA level. All VH and VL families were identified. Four different VH families were represented, VH3 being the most common as five of the mAbs (BY-7, BY-12, IRM-3, IRM-8 and CDC-1) used genetic elements of this family, whereas VH1, VH2 and VH4 were only present in IRM-7, BY-4 and IRM-10, respectively. BY-4, BY-7, BY-12, IRM-7 and IRM-10 reacted with a variety of self as well as non-self antigens, thus exhibiting polyreactive behaviour. Comparison of the gene segments utilized by these mAbs with their germline counterparts revealed that the gene segments were close to germline configuration. The length of H-CDR3 was found to be relatively long (27–60 nucleotides) among the polyreactive mAbs and the presence of Tyr and Trp residues in this region seems to be of vital importance for polyreactivity. We have analysed the utilization of gene elements and the presence of amino acid residues in regions particularly important for antigen binding, such as CDR. Common molecular features relating to the function of the mAbs are discussed.

Introduction

The presence of natural antibodies (Abs) able to react, generally with moderate intrinsic affinity, with multiple and dissimilar self as well as foreign antigens (Ags), such as proteins, nucleic acids, polysaccharides, cytoskeletal and tissue components, polypeptidic hormones and IgG, in the sera of normal non-immunized individuals is known.1,2 Such multi-reactive Abs are thought to be involved in the elimination of cellular debris and toxic substances, and to contribute to the homeostasis and/or competence of the primary humoral immune system. The majority of natural autoAbs are primarily polyreactive immunoglobulin M (IgM) encoded by a relatively small set of immunoglobulin V genes in near germ-line configuration. Because of their reactivity with various self Ags, it has been postulated that natural Abs can provide the templates for specific high-affinity autoAbs or Abs induced by Ags as found, for instance, in patients with autoimmune diseases. If natural polyreactive Abs provide the templates on which the pressure of an Ag selection process is exerted, they must use immunoglobulin gene segments similar to those used by high-affinity Abs and be able to accumulate somatic mutations of characteristic nature and distribution.

Several studies have indicated that the repertoires of V genes used for natural polyreactive Abs and for ‘regular’ Abs against foreign Ags overlap considerably, a property that may not be attributed only to the expression of certain V genes, but that may depend on other diversification mechanisms.35 The characteristic spectra of Ag-binding activities of polyreactive Abs presumably reflects fundamental differences in the structure of their Ag-binding sites, as compared with those of Ag-induced monoreactive specific Abs. The heavy-chain third complementarity-determining region (H-CDR3) is encoded by the D and flanking N regions and by the 5′-end of the JH gene segments, and is generally idiosyncratic to each VH gene rearrangement. The H-CDR3 forms the centre of the Ag-binding site and thus plays a prominent role in Ag binding. Moreover, previous sequence comparisons have pointed towards the critical role played by the H-CDR3 in distinguishing polyspecific from monospecific Ag-binding sites in natural and Ag-induced Abs.68

In the present work, we report the complete nucleotide sequence of VH and VL genes encoding eight IgM human autoreactive monoclonal antibodies (mAbs). Their production, characterization and binding to diverse Ags have been reported elsewhere.912 Analysis of sequence homologies led us to determine their germline counterparts, to detect mutations (if any) and to assess the alterations produced by these mutations in the amino acid sequence. We have specifically focused the analysis on H-CDR3 given its importance in Ag binding, as well as in the correlation between V-gene usage and Ab specificity.

Materials and methods

Heterohybridoma cell lines and human mAbs

Eight IgM-secreting human/mouse heterohybridomas were included in this study. They were derived from peripheral B cells isolated from three polytransfused individuals (BY-4 from donor APG; BY-7 and BY-12 from donor MOL; IRM-3, IRM-7, IRM-8 and IRM-10 from donor IRM), and a patient with scleroderma (CDC-1). The autoreactivity of the mAbs secreted by these clones was primarily defined by testing their reactivity by ELISA on cells as previously described.13 Further testing of these mAbs for their binding to diverse Ags912 allowed us to define mAbs from clones BY, as well as from clones IRM-7 and IRM-10, as polyreactive since they bound at least more than two Ags, although each mAb displayed unique fine specificities. On the other hand, mAbs from clones IRM-3, IRM-8 and CDC-1 were considered to be monospecific since they reacted only against Ro/SS-A (IRM-3 and CDC-1), and lipid-A (IRM-8). Additionally, mAbs from clones IRM were found to be autocytotoxic.11 The activity of these mAbs against the Fc fraction of purified human IgG, ssDNA, dsDNA, staphylococcal protein A (SPA), lipid A, phosphorylcholine (PC) and peptide T15H50–73 (synthesized by Multiple Peptide Systems, San Diego, CA) is summarized in Table 1.

Table 1.

Summary of the reactivity of the eight human mAbs included in this study against diverse Ags

mAb Poly- reactivity RF-like activity ssDNA dsDNA Auto- cytotoxicity Lipid A SPA PC T15H (50–73)
BY-4 + + + +
BY-7 + + + + +
BY-12 + + + + + + + +
IRM-3 + +
IRM-7 + + + + + +
IRM-8 + + +
IRM-10 + + + + +
CDC-1 +

DNA subcloning

Heterohybridoma cell lines were cultured in RPMI-1640 (Biochrom, Berlin, Germany) supplemented with 10% fetal bovine serum (FBS; Boehringer Mannheim, Mannheim, Germany), 2 mm l-glutamine (Sigma, St Louis, MO, USA) and 5 µg/ml gentamycin sulphate (Biochrom) at 37° in humidified air with 5% CO2. Total RNA was extracted from 106 exponentially growing hybridoma cells by the guanidinium thiocyanate method.14 First-strand cDNA was synthesized from 5 µg of total RNA with oligo(dT) as the primer and the using avian myeloblastosis virus (AMV) reverse transcriptase (Boehringer Mannheim). Amplification of cDNA was performed with family based back primers specific for the 5′-region of each VH and VL family and a Cµ, Cλ, or Cκ oligonucleotide to prime from the 3′-end, as previously described.15,16 DNA fragments were subcloned into the EcoRV restriction site of pBluescript KS+ cloning vector as recommended by the manufacturer (Stratagene, La Jolla, CA).

Sequencing of immunoglobulin VH and VL genes

DNA sequencing was carried out by the dideoxynucleotide technique of Sanger17 using T3 20-mer and KS 17-mer biotinylated synthetic oligonucleotide primers (Stratagene, La Jolla, CA). After electrophoresis, DNA was transferred to positively charged nylon membranes (Tropilon Plus, Tropix, Bedford, MA) by capillary action and immobilized on the membrane by UV irradiation. Membranes were processed using the Seq-Light chemiluminescent DNA sequencing system (Tropix), following the manufacturer's instructions. Each VH and VL gene sequence was generated from three independent clones derived from independent polymerase chain reactions (PCRs). Computer analysis of DNA sequences was performed using the University of Wisconsin Genetics Computer Group Sequence Analysis Software Package.18 The closest germline genes were identified by searching the v base and dnaplot sequence directory (I. Tomlinson, H. H. Althaus et al. MRC Centre for Protein Engineering, Cambridge, UK, and University of Cologne, Germany).

Results

Identification of the germline genes

As shown in Figs 1 and 2, all the Ab sequences had an open reading frame confirming an amino acid sequence representative of known gene families. The use of V (D) and J gene elements by the mAbs under study, as well as the results obtained from comparisons of the expressed V gene sequences with those of the closest germline V genes, are summarized in Table 2. The expressed VH gene sequences were 96·2–100% identical to those of reported germline VH sequences, whereas the expressed VL gene sequences were 97·0–100% homologous to those of reported germline VL sequences. The sequences of the H-chains revealed that members of the VH3 family, the largest and most heterogeneous VH gene family in humans, were used by five mAbs. This family has been found in many myeloma proteins of unknown specificity, as well as in autoAbs such as rheumatoid factors (RF) and anti-DNA Abs. Members of the VH1, VH2, and VH4 gene families were used by a single mAb each. The D gene segments used in these autoreactive mAbs could be ascribed to known germline D genes (Table 2). The mAb IRM-8 used a Dir element (D genes with irregular recombination signals). Analysis of the JH segments showed that JH4 was preferentially used (four clones rearranged with this gene segment) whereas three clones rearranged with JH6, and only one clone used the JH3 segment.

Figure 1.

Figure 1

Nucleotide sequences of the VH segments of mAbs IRM-8, IRM-10, CDC-1, BY-4 and BY-7 compared with their closest germline counterparts. Differences in sequence are indicated and the dashes mean identity. All the sequences are available from the EMBL/GenBank under the following accession numbers: IRM-8 U76685, IRM-10 U76681, CDC-1 U76679, BY-4 U77371, BY-7 U77372, BY-12 U77373, IRM-3 U77374and IRM-7 U77375.

Figure 2.

Figure 2

Nucleotide sequences of the VL genes of mAbs BY-12, BY-7 and BY-4 compared with their closest germline counterparts. Differences in sequence are indicated and the dashes mean identity. The sequences are available from the EMBL/GenBank under the following accession numbers: BY-12 U76676, BY-776678, BY-4 U76677, CDC-1 U76680, IRM-10 U76682, IRM-3 U76683, IRM-7 U76684 and IRM-8 U76686.

Table 2.

Germline counterparts of the gene segments coding for the variable regions of H- and l-chains

Nucleotide differences Nucleotide differences


CDR FR CDR FR




Clone Origin VH gene family Closest VH gene Nucleotide identity (%) R S R S D gene JH gene VL gene family Closest VL gene Nucleotide identity (%) R S R S JL gene
BY-4 P* VH2 DP-28 (VH2–70) 99·3 1 0 0 1 DXP′1 JH4 Vκ1 L24 97·0 3 0 1 1 Jκ1
BY-7 P VH3 DP-77 (VH3–21) 99·2 1 0 0 1 D21/9 JH4 Vλ3 HuiglvIII 99·4 1 0 1 0 Jλ1
BY-12 P VH3 VH26 (VH3–23) 100 0 0 0 0 DXP1 JH4 Vλ2 DPL12 99·4 1 1 0 0 Jλ2
IRM-3 P VH3 WHG26 100 0 0 0 0 D21/9 JH6 Vλ1 Huiglv1L1 100 0 0 0 0 Jλ2
IRM-7 P VH1 DP-14 (VH1–18) 99·6 0 0 0 1 DN1 JH6 Vλ2 DPL10 100 0 0 0 0 Jλ2
IRM-8 P VH3 VH26 (VH3–23) 98·2 2 0 3 0 DIR? JH3 Vλ2 IGLV6S1 99·4 1 0 1 0 Jλ2
IRM-10 P VH4 V71–2 98·5 1 1 1 1 DXP′1 JH6 Vκ3 Humkv325 99·4 0 1 0 0 Jκ1
CDC-1 S VH3 DP-54 (VH3–7) 96·2 4 2 4 1 DHFL16 JH4 Vλ3 IGLV3S2 99·6 0 0 0 1 Jλ2
*

Polytransfused individual;

scleroderma patient.

The sequences of the L-chains showed that three mAbs were encoded by Vλ2 genes, two used Vλ3 genes, one used a Vλ1 gene, one used a Vκ1 gene, and one mAb used a Vκ3 gene (Table 2). Analysis of the JL gene segments revealed that Jλ2 was preferentially used, since five clones rearranged with this segment. Two clones rearranged with Jκ1, whereas only one clone used the Jλ1 gene segment.

Analysis of somatic mutations

In general terms, very few or no mutations in the rearranged VH gene segments were found in the panel of mAbs under study. The VH gene segments of mAbs BY-12, IRM-3 and IRM-7 were expressed as germline-encoded sequences. BY-4, BY-7 and IRM-10 exhibited a low number of mutations. The mAbs IRM-8 and CDC-1 showed a higher number of mutations: IRM-8 exhibited five non-conservative exchanges and CDC-1 exhibited eight missense mutations. With regard to L-chains, the VL segments of mAbs IRM-3, IRM-7, IRM-10 and CDC-1 were in germline configuration. The VL segments of BY-12 and BY-7 showed one and two replacements in the amino acid composition, respectively, whereas BY-4 had four missense mutations.

The VH segment of BY-4 had two nucleotide changes which resulted in a single replacement of Ser60Thr in CDR2 (Fig. 1). Interestingly, the JH4 segment of this mAb exhibited a silent substitution at codon no. 7 (CAA to CAG) when compared with the germline sequence. This is likely to represent an allelic variant of this gene segment, since it was also found in the sequences of all JH4-bearer mAbs included in this study. There were five nucleotide changes in the BY-4 VL segment and these resulted in four amino acid replacements at the following positions: Ser30Arg and Ser31Thr in CDR1; Ala50Gly in CDR2 and Phe62Ile in FR3 (Fig. 2).

The H-chain of human polyreactive mAb BY-7 had two nucleotide changes in VH, although only one of them gave rise to a replacement (Ser54Thr) in the CDR2 (Fig. 1). The L-chain of this mAb had two nucleotides changes in VL resulting in two amino acid replacements; Arg20Lys in FR1 and Asp53Gly in CDR2, respectively (Fig. 2). The VH3 segment of BY-12 did not show any mutations. In the L-chain two nucleotide changes in Vλ were found, although only one of them, located in the last position of this segment, resulted in a replacement (Thr95Pro). The H-chain of IRM-8 contained five point mutations in the VH segment that resulted in five non-conservative exchanges in amino acid composition: Ala23Gly and Thr28Ala in FR1; Ala40Pro in FR2; Gly54Asp and Ser56Arg in CDR2 (Fig. 1). On the other hand, the VL segment of this mAb was identical to its germline counterpart. The VH segment of IRM-10 had four nucleotide changes that resulted in two amino acid replacements, Gly32Ser in CDR1 and Gly49Arg in FR2. The L-chain of this monoclonal exhibited a single nucleotide change which did not alter the amino acid sequence. Eleven nucleotide changes were found in the VH3 gene element of CDC-1 that resulted in eight amino acid replacements: Gln13Arg in FR1; Tyr32Phe, Met34Leu and Ser35Asn in CDR1; Lys52Ile in CDR2; Ala84Asp, Glu85Asp and Val89Ile in FR3 (Fig. 1). As stated above, the L-chain of CDC-1 had a single nucleotide change without any modification of the amino acid sequence.

H-CDR3 length and amino acid composition

The length of H-CDR3 varied from 27 nucleotides in BY-4 to 60 nucleotides in BY-12 and IRM-7 (Table 3). In the samples in this study, BY-7, BY-12, IRM-7 and IRM-10 exhibited a broader recognition pattern that correlated with a longer H-CDR3; however, BY-4, which also reacted against a wide variety of compounds, exhibited a shorter H-CDR3, whereas IRM-3 (longer H-CDR3) showed a more restrictive recognition pattern. It has been suggested that the presence of Tyr and Trp residues in H-CDR3 confer flexibility upon the Ab molecule.19 In relation to this, mAb IRM-7 had seven Tyr residues in this region, followed by IRM-3 with five, IRM-10 and BY-7 with four, BY-12 with three, BY-4 with two, and, finally, IRM-8 and CDC-1 with only one. When the presence of Trp residues in H-CDR3 was analysed, we found that BY-4, BY-12, IRM-7 and IRM-10 (those mAbs that reacted with a higher number of Ags) had a single such residue in this region.

Table 3.

Nucleotide sequence of the H-CDR3

mAb N D N J Length
IRM-3 GACA ATTACTATGATAGTAGTGGTT CCCTGAGGAGA TACTACTACGGTATGGACGTC JH6 57
IRM-7 GATTCGACA GAGTATAGCAGCAGCTGGTAC TACGG CTACTACTACTACGGTATGGACGTC JH6 60
IRM-10 GAGT TATGGTTCGGGGAG AAGAG CTACTACTACTACGGTATGGACGTC JH6 48
IRM-8 GATCGAGCGGCAACAGCCTACC ATGTTTTTGATATC JH3 39
CDC-1 GGTTC GGCTGGTA CCTCCCCCCGC CTTGACTAC JH4 33
BY-4 A ATTACCAGGG CTGGTTGGC TGACTAC JH4 27
BY-12 GCCTCCGGG GTATTACGATATTTTGACTGGTTA CCCGGAAAGGCC TACTTTGACTAC JH4 60
BY-7 GATTCGAC GTATTACTATGATAGTAGTGGTTA CAAAGGGCCGGC C JH4 45

Since D segments can be read in the three possible reading frames, the resultant immunoglobulin will have a completely different amino acid composition depending on the reading frame selected. The DXP′1 segment was found in two possible reading frames: the first in IRM-10 and the second in BY-4. Three mAbs had their DH segments translated in the second possible reading frame: BY-7, IRM-3 and CDC-1. The DH segments utilized by mAbs IRM-7 and BY-12 were in the first possible reading frame (Table 4).

Table 4.

H-CDR3 amino acid sequences

Clone N-DH-N sequence JH (CDR3) DH Reading frame
BY-7 DSTYYYDSSGYKGPA (JH4) D21/9 2
IRM-3 DNYYDSSGSLRR YYYGMDV (JH6) D21/9 2
BY-12 KASGVLRYFDWLPGKA YFDY (JH4) DXP1 1
IRM-10 ELWFGEK YYYYGMDV (JH6) DXPÂ1 1
BY-4 NYQGWLA DY (JH4) DXPÂ1 2
IRM-7 DSTEYSSSWYYG YYYYGMDV (JH6) DN1 1
CDC-1 GSAGTSPR LDY (JH4) DHFL16 2
IRM-8 KDRAATAY HVFDI (JH3) DIR?

The DH gene segment DXP′1 is used in two possible reading frames. The second reading frame of the D21/9 element is the richest in hydrophylic/aromatic residues. Those mAbs bearing a JH6 gene segment were rich in aromatic residues. Underlined: hydrophobic residues. In bold type: hydrophilic and aromatic residues

Discussion

In the present work we determined the nucleotide and predicted amino acid sequences of VH and VL genes from a panel of eight human IgM autoreactive mAbs, and investigated whether any of the common molecular features related to the functions of mAbs. The results obtained support the notion that, in some cases, anti-DNA specificity is germline encoded. We did not find an increase in the number of positively charged amino acid residues either in H-CDR or in L-CDR of the four mAbs that exhibited anti-DNA reactivity, although these mAbs shared some features with other IgM anti-DNA Abs that have been associated with this reactivity.20 Both IRM-7 and BY-12 reacted with dsDNA and ssDNA and they contained unmutated copies of the VH26 and DP-14 genes, respectively. Both also had in common L-chains with Vλ2 gene segments (DPL10 and DPL12, respectively). This is an interesting characteristic since the 8.12 anti-DNA-associated idiotype is exclusively encoded by members of the Vλ2 gene family.20 Two other DNA-binding mAbs reacted with either ssDNA (BY-4) or dsDNA (BY-7). BY-4 contained a DXP′1 gene found in a previously described anti-DNA IgM Ab, and a Vκ1 gene which is also an anti-DNA-associated 3I+ idiotype.21

RF shares important characteristics with natural autoAbs and seems to be encoded by the same VH gene repertoire.8 The L-CDR3 is typically nine amino acids long, the first seven residues being contributed by a particular VL segment, and the last two residues encoded by the JL segment.22 Several authors have described a number of autoAbs that contain one or two additional amino acids (mostly Pro and Gly) within the L-CDR3, particularly in RF.23,24 Stüber et al.25 hypothesized that those B cells that inappropriately regulate the insertion of N regions may be at increased risk for the production of autoAbs. The presence of additional amino acids at the Vκ–Jκ junction is rare, and the expansion of B-cell clones with unusual sequences at the Vκ–Jκ junction is often associated with Ag selection.24 Five mAbs exhibited RF-like activity: BY-12, IRM-7, BY-4, BY-7 and IRM-10. The L-chain of mAb IRM-10 was an unmutated copy of the Humkv325 gene of the Vκ3b family, frequently found in RF. These five mAbs with RF-like activity had longer L-CDR3 segments (10–11 residues) than those not presenting this reactivity. In BY-4 and IRM-10, this was due to N-region nucleotide additions coding for Pro and Arg, and Gly in the case of BY-7 (Table 5). The other three mAbs included in this study not exhibiting RF-like activity did not present extra codons at the junctions, and therefore had the usual L-CDR3 length of nine amino acids. An IgM RF (SSH23) from a normal individual has been described to be encoded by a VH2 segment and a Vκ2 chain;25 the H-chain of mAb BY-4, with RF-like activity, contained the DP-28 gene segment of the VH2 family, and a Vκ1 L-chain. The L-CDR3 of BY-4 was 10 amino acids long and contained two Pro residues; SSH23 also has a 10 amino acid long L-CDR3 with two Pro residues at the same position.

Table 5.

L-CDR3 nucleotide sequences of those mAbs with RF-like activity, indicating the origin of the codons and the deduced amino acid sequence

mAb L-CDR3
BY-4 Vκ1 N Jκ1
CAA CAG TAT TAT AGT TTC CCC CCG GCG TTC
Q Q Y Y S F P P A F
BY-7 Vλ3 N Jλ1
CAG GTG TGG GAT AGT AGT CGA GGA GTC TTC
Q V W D S S R G V F
BY-12 Vλ2 Jλ2
TGC TCA TAT GCA GGC AGC TAC CCT GTG GTA
C S Y A G S T P(*) V V
IRM-7 Vλ2 Jλ2
TGC TCA TAT GCA GGT AGT AGC ACC TAT GTG GTA
C S Y A G S S T Y V V
IRM-10 Vκ3 N Jκ1
CAG CAG TAT GGT AGC TCA CCT CCG ACG TTC
Q Q Y G S S P P T F

*P = Pro generated by point mutation of the original codon ACT (Thr)

A number of human lymphocytotoxic autoAbs have been described, among them Abs that react against the i Ag of red blood cells, and in some cases also against lipid A of bacterial lipopolysaccharide.26,27 The JH6 gene (rearranged in 18% of normal human circulating B-cells) was used by 79% of a group of anti-Rh blood group Abs.28 This may reflect structural requirements for Ag binding, since the majority of H-CDR3 segments encoded by JH6 result in the amino acid sequence Tyr-x-Met-Glu-Val. MAbs IRM-3, IRM-7 and IRM-10 have a similar sequence (Tyr-Gly-Met-Asp-Val) in common, encoded by the JH6 gene segment. On the other hand, IRM-8 did not exhibit this feature since it had a JH3 gene element (Table 4).

The localization of the contact sites for SPA binding in immunoglobulin-variable regions is not yet resolved. All the SPA-binder Abs were found to use VH3 family genes and certain residues showed a high degree of conservation.29,30 The VH3 sequences of the mAbs included in this study were in agreement with previous data indicating that eight residues at positions 9, 19, 27 (FR1), 48 (FR2), 67, 73, 78 and 82 (FR3), unique to members of the VH3 family, are important for SPA binding. Some of these residues located outside the classical Ab binding site might directly interact with SPA, thus providing a distinct binding site that includes two regions, one located within FR1, the other within H-CDR2/FR3 (Fig. 3).

Figure 3.

Figure 3

Amino acid sequences of the VH gene segments of SPA-binder mAbs and non-SPA binders. The residues thought to be involved in SPA interaction are marked with x (conserved but not unique to the VH3 family) and ⇑ (conserved and unique to VH3 SPA-binders). The blocks correspond to the regions described as critical for SPA binding: FR1 residues 9–27 and H-CDR2/FR3 residues 75–84.

Polyclonal anti-PC Abs of IgG and IgM isotypes have been isolated from human sera and tested for binding to the T15H50–73 peptide. These Abs share the property of self-binding with their murine counterparts.31 It is interesting to point out that Halpern et al.32 searched the sequence database for human immunoglobulin with homology to the T15H50–73 region and did not find any significant sequence similarities. The mAbs under study were tested for PC specificity and binding to T15H50–73 peptide: mAbs BY-4, BY-7, BY-12, IRM-7 and IRM-10 bound this peptide, whereas BY-12 and IRM-10 reacted against PC as well. Interestingly, none of these human mAbs had the amino acid sequence of the T15H50–73 peptide, which determines the murine T15 idiotype, in their VH segments. This implies that the primary structure responsible for binding the T15H50–73 peptide, and therefore for self-binding properties, can differ and thus the self-binding property can be maintained in evolution by different primary structures.

As some authors have suggested polyreactive Abs should have longer H-CDR3 (30–60 bases) than monoreactive Abs.2 We have analysed the length of the H-CDR3 regions of the mAbs used in this study and all of them were in general terms long (27–60 nucleotides), including those of the monoreactive Abs such as IRM-8 and CDC-1. It has been reported that the presence of Tyr and Trp residues in the H-CDR3 confers flexibility upon the Ab molecule and produces a malleable Ag-binding site capable of accomodating diverse Ags9 It is important to point out that BY-4, the mAb in this study with the shortest H-CDR3, contained one Trp residue and a variable number of Tyr, as was also the case for BY-12, IRM-7 and IRM-10, all of them able to bind multiple compounds. The two monoreactive mAbs, IRM-8 and CDC-1, did not contain Trp and only contained one Tyr residue. Taken together, our data support the importance of H-CDR3 for polyreactivity, although how individual amino acid residues in this region make one Ab polyreactive and another monoreactive is still not clear.

Acknowledgments

This study was supported by grants from the Fondo de Investigaciones Sanitarias (FIS 99/255, FIS 00/566 and FIS 00/0568) and from Plan Andaluz de Investigación (Grupo CTS 0197), Consejería de Educación y Ciencia, Junta de Andalucía, Spain.

Abbreviations

Ab

antibody

Ag

antigen

AMV

avian myeloblastosis virus

CDR

complementarity determining region

FR

framework region

H

heavy

Ig

immunoglobulin

L

light

mAb

monoclonal antibody

PC

phosphorylcholine

PCR

polymerase chain reaction

R

replacement

RF

rheumatoid factor

S

silent

SPA

staphylococcal protein A.

References

  • 1.Avrameas S. Natural autoantibodies. Immunol Today. 1991;12:154–9. doi: 10.1016/S0167-5699(05)80045-3. [DOI] [PubMed] [Google Scholar]
  • 2.Riboldi P, Kasaian MT, Mantovani L, Ikenatsu H, Casali P. Natural antibodies. In: Bona CA, Siminovitch K, Zanetti M, Theofilopoulos AN, editors. The Molecular Pathology of Autoimmune Disease. Chur: Harwood Academic Publishers GmbH; 1993. pp. 45–64. [Google Scholar]
  • 3.Huang DF, Olee T, Masuho Y, Matsumoto Y, Carson DA, Chen PP. Sequence analysis of three IgG anti-virus antibodies reveals their utilization of autoantibody-related immunoglobulin VH genes but not Vλ genes. J Clin Invest. 1992;90:2197–208. doi: 10.1172/JCI116105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Chen C, Stenzel-Poore MP, Rittenberg MB. Natural auto- and polyreactive antibodies differing from antigen-induced antibodies in the H-chain CDR3. J Immunol. 1991;7:2359–67. [PubMed] [Google Scholar]
  • 5.Ikematsu H, Harindranath N, Ueki Y, Notkins AL, Casali P. Clonal analysis of a human antibody response. Sequences of the VH genes of human IgM, IgG and IgA to rabies virus reveal preferential utilization of VHIII segments and somatic hypermutation. J Immunol. 1993;150:1325–37. [PMC free article] [PubMed] [Google Scholar]
  • 6.Ichiyoshi Y, Casali P. Analysis of the structural correlates for antibody polyreactivity by multiple reassortments of chimeric human immunoglobulin heavy and light chain V segments. J Exp Med. 1994;180:885–95. doi: 10.1084/jem.180.3.885. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Martin T, Crouzier R, Weber JC, Kipps TJ, Pasquali JL. Structure-function studies on a polyreactive (natural) autoantibody. Polyreactivity is dependent on somatically generated sequences in the third complementarity-determining region of the antibody heavy chain. J Immunol. 1994;1562:5988–96. [PubMed] [Google Scholar]
  • 8.Crouzier R, Martin T, Pasquali JL. Heavy chain variable region, Light chain variable region, and heavy chain CDR3 influences on the mono- and polyreactivity and on the affinity of human monoclonal rheumatoid factors. J Immunol. 1995;154:4526–35. [PubMed] [Google Scholar]
  • 9.González MF, Wichmann I, Yélamos J, Melero J, Magariño R, Sánchez Roman J, Núñez-Roldán A, Sánchez B. A human monoclonal autoantibody to a nucleolar structure. Clin Exp Immunol. 1992;88:324–8. doi: 10.1111/j.1365-2249.1992.tb03081.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Sánchez B, Yélamos J, Melero J, Magariño R, Gonzalez MF, García R, Ríos C, Núñez-Roldán A. Production of heterohybridomas secreting autoreactive and polyreactive human monoclonal antibodies. Scand J Immunol. 1992;35:33–41. doi: 10.1111/j.1365-3083.1992.tb02831.x. [DOI] [PubMed] [Google Scholar]
  • 11.Robledo MM, Melero J, Dinca L, Tarragó D, García-Lozano JR, Núñez-Roldán A, Sánchez B. Human lymphocytotoxic monoclonal antibodies from a highly sensitized renal dialysis patient. Transplantation. 1995;59:1613–7. [PubMed] [Google Scholar]
  • 12.Melero J, Aguilera I, Mageed RA, Jefferis R, Tarragó D, Núñez-Roldán A, Sánchez B. The frequent expansion of a subpopulation of B cells that express RF-associated cross-reactive idiotypes: Evidence from analysis of a panel of autoreactive monoclonal antibodies. Scand J Immunol. 1998;48:152–8. doi: 10.1046/j.1365-3083.1998.00373.x. [DOI] [PubMed] [Google Scholar]
  • 13.Sánchez B, Melero J, Robledo MM, Tarragó D, Yélamos J, Gonzalez MF, Núñez-Roldán A. Application of cellular ELISA (CELISA) to the detection of human monoclonal autoantibodies. Human Antibod Hybridomas. 1993;4:198–202. [PubMed] [Google Scholar]
  • 14.Chomczynski P, Sacchi N. Single step method of RNA isolation by acid guanidinium thiocyanate phenol-chloroform extraction. Anal Biochem. 1987;162:156–9. doi: 10.1006/abio.1987.9999. [DOI] [PubMed] [Google Scholar]
  • 15.Marks JD, Tristem M, Karpas A, Winter G. Oligonucleotide primers for polymerase chain reaction amplification of human immunoglobulin variable genes and design of family-specific oligonucleotide probes. Eur J Immunol. 1991;21:985–91. doi: 10.1002/eji.1830210419. [DOI] [PubMed] [Google Scholar]
  • 16.Tarragó D, Aguilera A, Melero J, Wichmann I, Núñez-Roldán A, Sánchez B. Identification of cation-independent mannose 6-phosphate receptor/insulin-like growth factor type-2 receptor as a novel target of autoantibodies. Immunology. 1999;98:652–62. doi: 10.1046/j.1365-2567.1999.00889.x. 10.1046/j.1365-2567.1999.00889.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA. 1977;74:5463–7. doi: 10.1073/pnas.74.12.5463. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Devereux J, Haeberli P, Smithies O. A comprehensive set of sequence analysis for the VAX. Nucl Acid Res. 1984;12:387–95. doi: 10.1093/nar/12.1part1.387. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Mian S, Bradwell AR, Olson J. Structure, function and properties of antibody binding sites. J Mol Biol. 1991;217:133–51. doi: 10.1016/0022-2836(91)90617-f. [DOI] [PubMed] [Google Scholar]
  • 20.Paul E, Iliev AA, Livneh A, Diamond B. The anti-DNA-associated idiotype 8.12 is encoded by the V lambda II gene family and maps to the vicinity of L chain CDR1. J Immunol. 1992;149:3588–95. [PubMed] [Google Scholar]
  • 21.Manheimer-Lory A, Katz JB, Pillinger M, Ghossein C, Smith A, Diamond B. Molecular characteristics of antibodies bearing an anti-DNA-associated idiotype. J Exp Med. 1991;174:1639–52. doi: 10.1084/jem.174.6.1639. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Victor KD, Capra JD. An apparently common mechanism of generating antibody diversity: length variation of the VL-JL junction. Mol Immunol. 1994;31:39–46. doi: 10.1016/0161-5890(94)90136-8. [DOI] [PubMed] [Google Scholar]
  • 23.Martin T, Blaison G, Levallois H, Pasquali JL. Molecular analysis of the VkIII-Jk junctional diversity of polyclonal rheumatoid factors during rheumatoid arthritis frequently reveals N addition. Eur J Immunol. 1992;22:1773–9. doi: 10.1002/eji.1830220716. [DOI] [PubMed] [Google Scholar]
  • 24.Lee SK, Bridges Sl, Jr, Kirkham PM, Koopman WJ, Schroeder Hw., Jr Evidence of antigen receptor-influenced oligoclonal B lymphocyte expansion in the synovium of a patient with longstanding rheumatoid arthritis. J Clin Invest. 1994;93:361–70. doi: 10.1172/JCI116968. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Stüber F, Lee SK, Bridges Sl, Jr, Koopman WJ, Schroeder Hw, Jr, Gaskin F, Fu SM. A rheumatoid factor from a normal individual encoded by VH2 and VκII gene segments. Arthritis Rheum. 1992;35:900–4. doi: 10.1002/art.1780350808. [DOI] [PubMed] [Google Scholar]
  • 26.Cunningham CC, Weber BK, Muzairai IA, Grabowski PG, Power DA. A human lymphocytotoxic autoantibody is encoded by antibody variable region genes in their germ line configuration. Transplantation. 1993;56:1236–42. doi: 10.1097/00007890-199311000-00036. [DOI] [PubMed] [Google Scholar]
  • 27.Parr TB, Johnson TA, Silverstein LE, Kipps TJ. Anti-B cell autoantibodies encoded by VH 4–21 genes in human fetal spleen do not require in vivo somatic selection. Eur J Immunol. 1994;24:2941–9. doi: 10.1002/eji.1830241204. [DOI] [PubMed] [Google Scholar]
  • 28.Bye JM, Carter C, Ciu Y, Gorick BD, Songsivilai S, Winter G, Hughes-Jones NC, Marks JD. Germline variable region gene segment derivation of human monoclonal anti-Rh (D) antibodies. Evidence for affinity maturation by somatic hypermutation and repertoire shift. J Clin Invest. 1992;90:2481–90. doi: 10.1172/JCI116140. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Potter KN, Li Y, Capra D. Staphylococcal protein A simultaneously interacts with framework region 1, complementarity-determining region 2, and framework region 3 on human VH3-encoded immunoglobulins. J Immunol. 1996;157:2982–8. [PubMed] [Google Scholar]
  • 30.Randen I, Potter KN, Li Y, Thompson KM, Pascual V, Forre O, Natvig JB, Capra JD. Complementarity-determining region 2 is implicated in the binding of staphylococcal protein A to human immunoglobulin VHIII variable regions. Eur J Immunol. 1993;23:2682–6. doi: 10.1002/eji.1830231044. [DOI] [PubMed] [Google Scholar]
  • 31.Kaveri S, Kang C, Köhler H. Natural mouse and human antibodies bind to a peptide derived from a germline VH chain. J Immunol. 1990;145:4207–13. [PubMed] [Google Scholar]
  • 32.Halpern R, Kaveri S, Köhler H. Human anti-phosphorylcholine antibodies share idiotypes and are self-binding. J Clin Invest. 1991;88:476–82. doi: 10.1172/JCI115328. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Immunology are provided here courtesy of British Society for Immunology

RESOURCES